How to rename fasta headers according to a matching name list
FaBox has several utilities to manipulate the FASTA sequence. I wanted to replace the FASTA header with the new header or description which...
Sanjay Singh
Scientist/Writer
- Emailsanjaysingh765@gmail.com
- Socail@lampatlex
- VisitorSince 1982
- LocationKentucky, USA
Blog
Topics
How to Extract Multiple Sequence from Multi Fasta File with PERL-III
This is another PERL script to extract the FASTA sequence from a file by their accession number or ID stored in another file. 1. How to Extr...
Sort FASTA File by Sequence Name
Problem I got a multi fasta file containing several isoform of the same locus. So my task was to get rid of the multiple version of same gen...
Learn PERL Basic with Me : NCBI BLAST parser IV
Today's PERL script is very similar to the PERL script I shared yesterday . It will parse the NCBI blast output just like the previous o...
Learn PERL Basic with Me : NCBI BLAST parser III
I have already shared different parser to analyse the NCBI blast results. You can extract the best hits from your blast result file but thi...
NCBI BLAST parser : Extract query and best hits II
If you have been redirected to this post from Google or any search engine, you probably had entered “ NCBI BLAST parser ” or so in a despera...
How to Extract Multiple Sequence from Multi Fasta File with PERL - II
Previously I have shared a PERL script to extract multiple sequence from multi FASTA file with PERL . So if you have accession numbers store...
How to Extract Longest Sequence Region Between Stop Codons in Translated DNA Sequences
So you have so many FASTA sequence in a file have translated those multiple nucleotide sequences and now you want to extract the region with...
Extracting FASTA Sequences Based on Position WITH PERL Script
Previously, I have shared two different methods to extract fasta sequences based on position. For example, if you have coordinates for the n...
How to Get Accession Numbers from FASTA File from GenBank
Say if have retrieved multiple FASTA Sequences using Uniprot ID from Uniprot or NCBI and now you want to get the accession numbers from FA...
How to Remove All Empty Fasta Sequences from a file using PERL script
Suppose a condition a where you have a file with multiple fasta file which contain several hundred FASTA sequence but few of them have only ...
How to Split Multi line FASTA Files with PERL Script
Recently someone anonymous (surprisingly most of the reader who comment on this blog are anonymous) asked for a PERL script to split a multi...
How to BLAST multiple sequences against NCBI database using PERL script - II
Previously, I shared a PERL script to perform batch BLAST to the NCBI server . This PERL script uses Bioperl modules so make sure that biop...
How to Add FASTA Description to Multiple Sequences
So you have a multi-fasta file like this GGCGGATGTAGCCACGTGGATCGGCGGATGTAGCCACGTGGATCGGCGGATGTAGCCACGTGGATCGGCGGATGTAGCCACGTGGATC AGCTGCTG...
How to retrieve NCBI GenBank records with a range of accession numbers
I have previously discussed the way to download the sequence from NCBI database if you have a list of accession numbers. But what if you h...
How to Remove Duplicate Sequences from a multi fasta Files
Most common problems with sequence analysis is presence of duplicate sequence in data sets. Even protein or nucleotide sequences downloaded ...
How to Extract FASTA Header With PERL Script
Previously I have already shared some tricks and PERL script to extract the FASTA header fro multi FASTA files. I am adding another PERL scr...
How to Parse/Edit FASTA header
Imagine a situation that you have thousands of FASTA sequences in a file and want to shorten or edit the FASTA header instead of whole long ...
How to Extract Multiple Sequence from Multi Fasta File with PERL
Yesterday, we talked about NCBI BLAST parsing . I shared two PERL script than can parsed BLAST results in tabulated manner so that you can a...
NCBI BLAST parser : Extract query and best hits
BLAST is a wonderful utility for sequence analysis studies. Bioinformatic analysis of thousand of sequences without BLAST is unthinkable. Bu...