NCBI BLAST parser : Extract query and best hits II
If you have been redirected to this post from Google or any search engine, you probably had entered “ NCBI BLAST parser ” or so in a despera...
Sanjay Singh
Scientist/Writer
- Emailsanjaysingh765@gmail.com
- Socail@lampatlex
- VisitorSince 1982
- LocationKentucky, USA
Blog
Topics
How to Extract Multiple Sequence from Multi Fasta File with PERL - II
Previously I have shared a PERL script to extract multiple sequence from multi FASTA file with PERL . So if you have accession numbers store...
How to Extract Longest Sequence Region Between Stop Codons in Translated DNA Sequences
So you have so many FASTA sequence in a file have translated those multiple nucleotide sequences and now you want to extract the region with...
Extracting FASTA Sequences Based on Position WITH PERL Script
Previously, I have shared two different methods to extract fasta sequences based on position. For example, if you have coordinates for the n...
How to Get Accession Numbers from FASTA File from GenBank
Say if have retrieved multiple FASTA Sequences using Uniprot ID from Uniprot or NCBI and now you want to get the accession numbers from FA...
How to Retrieving Multiple FASTA Sequence using Uniprot ID
Previously, I have shared two different tools to retrieve multiple sequence from NCBI. One was used to retrieve the many sequence record fro...
DNA to RNA to Protein Transcription and Translation Tool
Converts DNA to RNA to protein DNA sequence RNA sequence Protein sequence
Extract Part of a FASTA Sequences with Position
Update: 5.29.2018 Bedtools are another nice tool to extract defined regions sequence from FASTA file. Install Bedtools on your Ubuntu machi...
How to Split Multi line FASTA Files with PERL Script
Recently someone anonymous (surprisingly most of the reader who comment on this blog are anonymous) asked for a PERL script to split a multi...
How to BLAST multiple sequences against NCBI database using PERL script - II
Previously, I shared a PERL script to perform batch BLAST to the NCBI server . This PERL script uses Bioperl modules so make sure that biop...
How to Add FASTA Description to Multiple Sequences
So you have a multi-fasta file like this GGCGGATGTAGCCACGTGGATCGGCGGATGTAGCCACGTGGATCGGCGGATGTAGCCACGTGGATCGGCGGATGTAGCCACGTGGATC AGCTGCTG...
How to Remove Duplicate Sequences from a multi fasta Files
Most common problems with sequence analysis is presence of duplicate sequence in data sets. Even protein or nucleotide sequences downloaded ...
How to Extract FASTA Header With PERL Script
Previously I have already shared some tricks and PERL script to extract the FASTA header fro multi FASTA files. I am adding another PERL scr...
How to Parse/Edit FASTA header
Imagine a situation that you have thousands of FASTA sequences in a file and want to shorten or edit the FASTA header instead of whole long ...
How to Use New NCBI BLAST Result Interface
On NCBI BLAST result page (right up corner, in red font), you might notice a notification ' View these results in the new enhanced repo...
How to Extract Multiple Sequence from Multi Fasta File with PERL
Yesterday, we talked about NCBI BLAST parsing . I shared two PERL script than can parsed BLAST results in tabulated manner so that you can a...
NCBI BLAST parser : Extract query and best hits
BLAST is a wonderful utility for sequence analysis studies. Bioinformatic analysis of thousand of sequences without BLAST is unthinkable. Bu...
How to Filter the Sequence by Their Length
PERL scripts are most wonderful stuff because they can help you in almost all aspect of Bioinformatics. PERL script can perform BLAST , par...